Phis1522
WebbTable S1. Oligonucleotides used in this study. Related to STAR Methods section. Name Sequence (5'-3') Purpose BoNTA_10R GGCCGGCATGCGGCCGGTACCCTCACTGCAGCGGACGTTCGCC Webb载体简介. Plasmids pHIS1522/pHIS1525 both contain the strong xylA promoter (PxylA) originating from Bacillus megaterium. Transcription from this promoter is xylose …
Phis1522
Did you know?
Webb27 feb. 2024 · IPTG act as a molecular mimic of allolactose and initiate transcription of lac operon and trigger expression of the inserted genes under the control of this Lac operon (in this case HriGFP gene). The HriGFP pet28+ construct was directly transformed in E. coli (BL21DE3 cells), however, for transformation in Bacillus megaterium the gene was sub ... WebbJuly 13, 2015: Primers were ordered for the pHis1522-aTcdB and pHsp70-Cas9 vectors. The primers were designed to install 21 extra bp at the ends, to be used as homologous …
Webb6 nov. 2008 · Results: The toxin genes tcdA and tcdB were amplified by PCR using chromosomal DNA from a toxigenic strain as a template, and cloned into a shuttle vector … WebbBacillus megaterium vector, pHIS1522. Description: Bacillus megaterium Expression Systems: The B. megaterium expression system provides a versatile and easy-to-handle …
Webb11 apr. 2024 · pair 5556, bases 5261556 were AGI-6780 chemical information amplified and ligated into pHis1522-TcdB1-5260 through SpeI and BamHI restriction sites. The resulting construct pHis1522-TcdB1556 encodes the C-terminal truncated TcdB1852. All constructs were sequenced. WebbHuge Selection of Cloning and Expression Vectors. MoBiTec is leading in the development of unique and cutting edge vector systems for recombinant protein expression. We offer …
WebbCheck out relevant papers found by Labettor's AI that are relevant for performing Protein Expression Prokaryotic cells - Brevibacillus choshinensis SP3 α-amylase using SEC-GFP …
WebbB Megaterium Expression Vector Phis1522, supplied by Mobitec Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, … fishing in puerto vallarta in marchWebb21 mars 2016 · Size-reduced pHIS1522 variant with sequence for C-terminal StrepII-tag fusion (including stop codon directly downstream of the tag). pN-His-TEV1622 Like … fishing in rain tipsWebbpC-Strep1622 (BMEG21)-size-reduced pHIS1522 variant with sequence for C-terminal StrepII-tag fusion (including stop codon directly downstream of the tag). Vectors of the … can bluetooth speakers connect to a pcWebbNational Center for Biotechnology Information fishing in rancho cucamongaWebb6 nov. 2008 · Background Major Clostridium difficile virulence factors are the exotoxins TcdA and TcdB. Due to the large size and poor stability of the proteins, the active recombinant TcdA and TcdB have been difficult to produce. Results The toxin genes tcdA and tcdB were amplified by PCR using chromosomal DNA from a toxigenic strain as a … can bluetooth speakers be used with pcWebbpHIS1522 (MoBiTec), the gene was amplified by PCR from genomic DNA (C.novyi strain 6018) in two parts. First, the upstream sequence of an intrinsic SpeI restriction site at bp 2965 was amplified with oligonucleotides introducing a 5-BsrGIrestrictionsite,andsecond,thedownstreamsequence of the SpeI restriction site was … can bluetooth speakers cause cancerWebbTaKaRa brevibacillus competent cells takara bio Brevibacillus Competent Cells Takara Bio, supplied by TaKaRa, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. fishing in red dead